rs740839 chr12:6229471 C>T
- Sequence
cccctctggggcaaagaagtacag[C/T]gtgtggcaaatggaattccattgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) HT29 (colon adenocarcinoma)
- ASB for transcription factors
- ESR1_HUMAN NR1H3_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.53 | 1.30 | 2.00 | n/a | No Hit | |||
| NR1H3_HUMAN | 1.60 | -0.99 | 2.00 | n/a | No Hit | |||
| GRHL2_HUMAN | 1.48 | 0.25 | 1.94 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, eur students <30 digit span forward, hdl cholesterol, obesity with early age of onset (age >2), total cholesterol change with statins