rs740936 chr4:81406263 T>G
- Sequence
aataaagaccccttaaatactgaa[T/G]gttcatttttctttttggaaagtt
- ASB in cell types
- CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 1.08 | -3.69 | 2.50 |
Items per page:
1 – 1 of 1