rs741166 chr16:5055439 T>C
- Sequence
gggctgccacggtgccacctgcct[T/C]catctgcctgggttaggcttagga
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | n/a | 2.11 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, irritible bowel syndrome, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Stomach, Testis, Thyroid