rs74139685 chr10:70550024 G>T
- Sequence
gagggcccagaggcaagatgtaga[G/T]tcattctgggatatggccaccagg
- ASB in cell types
- epidermal keratinocytes CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 1.34 | 0.24 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 1.29 | n/a | 2.50 |
Items per page:
1 – 2 of 2