rs742071 chr1:18653380 G>T
- Sequence
tattgttgttgttgttgcaacggt[G/T]ctgtgtacgcacggttacagtgga
- ASB in cell types
- Jurkat (T-cells)
- ASB for transcription factors
- MYB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYB_HUMAN | -0.31 | 1.11 | 1.71 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI nonsyndromic cleft lip with cleft palate, nonsyndromic cleft lip with or without cleft palate, orofacial clefts
GRASP cleft lip, with or without cleft palate, cleft lip, with or without cleft palate, in european ancestry population, nonsyndromic cleft lip, salmonella-induced pyroptosis, schizophrenia, tetrology of fallot