rs742225 chr6:11770570 A>G
- Sequence
ggccgggggtagaagagccagaag[A/G]taggaaatcatgggccctggggtg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.43 | 0.68 | 2.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, hypertension (early onset hypertension), infant head circumference, stabilized warfarin dose