rs742600 chr20:50441492 G>A
- Sequence
agcttcagaggctccactacagca[G/A]tttagactctaattacatttactg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.13 | 0.75 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.09 | -0.86 | 4.16 |
Items per page:
1 – 2 of 2