rs743302 chr21:34603172 T>C
- Sequence
ttgcctttgatgcctgaaataaag[T/C]gtaagtcaaccagcaagctccact
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) neural cell T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.99 | -0.69 | 3.48 | |||
| GM12878 (female B-cells) | 0.47 | 0.59 | 1.28 | |||
| neural cell | -0.14 | 0.58 | 1.00 | |||
| T47D (invasive ductal carcinoma) | -0.26 | 1.29 | 2.00 |
Items per page:
1 – 4 of 4