rs743523 chr22:22061828 C>T
- Sequence
gtgcactctgatctgtaactattg[C/T]gcaaatattacaacagagcctgtc
- ASB in cell types
- tibial nerve epithelial cell of prostate HL-60 (acute myeloid leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN SKI_HUMAN EP300_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.11 | 0.59 | 1.33 | n/a | No Hit | |||
| SKI_HUMAN | 2.99 | n/a | 3.00 | n/a | n/a | |||
| EP300_HUMAN | 1.65 | -0.48 | 1.33 | n/a | n/a | |||
| RFX1_HUMAN | -0.30 | 1.97 | 2.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, fasting insulin, homa-ir, maternal transmission distortion, transmission distortion, years of education