rs744034 chr2:9984680 C>T
- Sequence
ggatccccctggatgggttctcgc[C/T]ggcttagtgcattgctcaggcaca
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.35 | 0.95 | 1.99 | |||
| foreskin keratinocyte | 1.17 | -0.81 | 1.75 |
Items per page:
1 – 2 of 2