rs74415035 chr15:84845704 A>G
- Sequence
aaaaacttcgagaataaaaacact[A/G]atgaaccatcatgtaagtcccaca
- ASB in cell types
- gastroesophageal sphincter epidermal keratinocytes hepatocytes smooth muscle cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | -0.77 | 0.77 | 1.00 | |||
| epidermal keratinocytes | 1.30 | -0.53 | 2.00 | |||
| hepatocytes | -0.50 | 1.28 | 1.00 | |||
| smooth muscle cell | -1.23 | 1.44 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid