rs744154 chr16:13921224 G>C
- Sequence
aaataggacattcaccaaggctgt[G/C]ttaagagggccatagggtcagaaa
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.10 | 0.55 | 1.91 | |||
| K562 (myelogenous leukemia) | -0.36 | 0.58 | 2.00 |
Items per page:
1 – 2 of 2