rs744439 chr14:95741453 G>T
- Sequence
agctaccacgtgggagacactcat[G/T]ctcctctacacggagccctcccct
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- HIF3A_HUMAN HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF3A_HUMAN | 3.05 | n/a | 1.50 | n/a | n/a | |||
| HIF1A_HUMAN | 2.13 | -2.42 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, hdl cholesterol change with statins, hypertension (early onset hypertension), neuroblastoma (brain cancer), resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (females), suicide attempts in bipolar disorder (substance free)