rs74471685 chr16:57186428 C>G
- Sequence
gccgccgccgccgccccctccctc[C/G]ggtgggcccgggaggtagagaaag
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.82 | 0.19 | 1.82 | |||
| HEK293T (embryonic kidney) | -0.55 | 1.20 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid