rs74508575 chr1:16904518 C>G
- Sequence
ttataacactactactcgtaaaac[C/G]agtaaggatggctggtttgcagtt
- ASB in cell types
- transverse colon gastroesophageal sphincter adrenal gland upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.33 | 0.14 | 1.35 | n/a | No Hit | |||
| EP300_HUMAN | 1.06 | -0.48 | 1.46 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Cerebellum, Esophagus_Mucosa, Liver, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood