rs745697 chr1:223848140 G>T
- Sequence
ttgtgataagccaagcaaaagatg[G/T]aagtggcttgctcaaaggcgataa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- REQU_HUMAN MTA2_HUMAN FOXK2_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REQU_HUMAN | n/a | 2.58 | 2.75 | n/a | n/a | |||
| MTA2_HUMAN | -2.41 | 2.15 | 2.50 | n/a | n/a | |||
| FOXK2_HUMAN | -2.92 | 1.95 | 2.50 | n/a | n/a | |||
| HDAC1_HUMAN | -2.68 | 1.92 | 2.67 | n/a | n/a | |||
| KDM1A_HUMAN | -2.83 | 2.20 | 2.50 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood