rs745941 chr3:126925581 C>A
- Sequence
cctcttcctcatctgaccatgagc[C/A]gcagaagggctacttcctctgcca
- ASB in cell types
- monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.13 | 2.20 | 1.88 | n/a | No Hit | |||
| TF65_HUMAN | 1.31 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, bipolar disorder, hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), parkinsons disease, partial epilepsy, premature ovarian failure, schizophrenia, tetrology of fallot, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood