rs746700 chr1:30824672 T>C
- Sequence
ccaggccggcgttgcagagggatg[T/C]tcggaggaagctccgggcgggaga
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -0.56 | 1.73 | 2.00 | 3.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
