rs746800 chr6:168133107 A>G
- Sequence
cttctccacttactgggttgtccc[A/G]gaaccattgtctgatgcctgagat
- ASB in cell types
- HepG2 (hepatoblastoma) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.52 | 1.24 | 2.00 | |||
| epithelial cell of prostate | 1.76 | -1.69 | 1.00 |
Items per page:
1 – 2 of 2