rs747051 chr2:176002403 G>A
- Sequence
ttgttggggcgggtcggccgggag[G/A]ttaggatcttgtgtttgtggcctc
- ASB in cell types
- HepG2 (hepatoblastoma) CD34+ bone marrow cell-derived erythroid progenitors K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN USF1_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -3.65 | 2.90 | 1.83 | n/a | No Hit | |||
| USF1_HUMAN | 0.99 | 0.10 | 1.65 | n/a | No Hit | |||
| CREB1_HUMAN | 0.94 | -0.42 | 1.89 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Thyroid, Whole_Blood