rs747524 chr11:79060987 T>G
- Sequence
ggcccaggggtttgttgaggtcag[T/G]gggaactagagaaagatgggagaa
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -1.50 | 1.36 | 2.17 | 0.50 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, arthritis including non-rheumatoid, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, longstanding arthritis, refractive error, sporadic creutzfeldt-jakob disease