rs747985 chr14:92637745 G>A
- Sequence
aagctcttggtgagtgactgataa[G/A]gcttaacaagtgatagctcctttt
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA4_HUMAN | 1.94 | -1.84 | 1.33 | -2.67 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
