rs7483870 chr11:976019 G>A
- Sequence
ttgtagccacaagcatggaacctg[G/A]ttggctcttctatgttgaaggact
- ASB in cell types
- A549 (lung carcinoma) erythroid cells bipolar neuron neural cell
- ASB for transcription factors
- SMC3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -0.73 | 1.32 | 1.89 | n/a | n/a | |||
| RAD21_HUMAN | -0.41 | 0.97 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood