rs748571 chr2:61630950 G>A
- Sequence
agctaaagattgcttgcggggaac[G/A]caggtagcacagtgtgtatctcac
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.23 | 1.65 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, obesity with early age of onset (age >2), rheumatoid arthritis, serum creatinine, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood