rs748949 chr7:158704586 C>T
- Sequence
cagttccgtcagaggcagcactgc[C/T]cgcacgcaggtcggccgcctcctt
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.28 | 0.79 | 1.94 | |||
| HEK293T (embryonic kidney) | -0.20 | 0.85 | 1.91 | |||
| GM12878 (female B-cells) | 0.37 | 0.58 | 1.28 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Thyroid, Whole_Blood