rs75011301 chr1:168288548 A>G
- Sequence
cctttaaataaaaataaaacaaac[A/G]aaagtgtctcgccttaagtcattt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MEIS2_HUMAN KDM1A_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 2.66 | 2.50 | n/a | No Hit | |||
| KDM1A_HUMAN | -2.62 | 2.35 | 3.00 | n/a | n/a | |||
| NR2C1_HUMAN | -3.24 | 1.71 | 2.75 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood