rs750185 chr2:31138619 G>A
- Sequence
ctaccgccgcccgccgaccgaaac[G/A]ctcggtgctgttgcggggccgcca
- ASB in cell types
- VCaP (prostate carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | n/a | 2.81 | 2.00 | |||
| foreskin keratinocyte | 0.44 | -1.36 | 2.11 |
Items per page:
1 – 2 of 2