rs750439 chr1:156460957 C>T
- Sequence
aagatggggaggatggattggaaa[C/T]ggggaaggtggggggtgagagaaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN NCOR1_HUMAN MTG8R_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -2.71 | 2.09 | 2.00 | n/a | No Hit | |||
| NCOR1_HUMAN | -1.56 | 1.83 | 2.00 | n/a | n/a | |||
| MTG8R_HUMAN | -2.85 | 2.14 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), homa-b, microalbuminuria, salmonella-induced pyroptosis, schizophrenia, systolic blood pressure (sbp), triglycerides change with statins