rs750897 chr15:100732776 A>G
- Sequence
aggagaaaggtcacagtggcttgg[A/G]gatgaattccaggacacagcactg
- ASB in cell types
- breast tumor tissue SK-BR-3 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | -1.50 | 1.62 | 2.00 | |||
| SK-BR-3 (breast adenocarcinoma) | -0.48 | 1.05 | 1.50 |
Items per page:
1 – 2 of 2