rs751297 chr4:81165001 A>G
- Sequence
ttccatactgcataactgccaggt[A/G]cgtaagtcatattattattttcat
- ASB in cell types
- HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | -0.40 | 1.43 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, decrease in fev1/fvc ratio (in asthmatic participants), hdl cholesterol, ldl cholesterol change with statins, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants), systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Thyroid