rs75139949 chr9:99266759 T>C
- Sequence
gcagcccaccagaatggagcccgc[T/C]ggtctgcaaaaccacaggtgcctc
- ASB in cell types
- erythroid progenitors H54
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.14 | -3.10 | 2.00 | |||
| H54 | 2.00 | -2.47 | 1.50 |
Items per page:
1 – 2 of 2