rs75142350 chr11:12412462 G>A
- Sequence
ggaatgaggtgtgagtatggaaag[G/A]accaccagggggctccgggatgca
- ASB in cell types
- erythroid progenitors MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.70 | n/a | 2.50 | |||
| MM1.S (plasma cell myeloma) | -0.60 | 1.08 | 1.28 |
Items per page:
1 – 2 of 2