rs751481 chr3:23727375 A>G
- Sequence
aattagatcctccttcttgatggg[A/G]gtgaccttggcctggccagtctga
- ASB in cell types
- GM12878 (female B-cells) cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.55 | 0.15 | 1.32 | |||
| cranial neural crest cells | 1.87 | -1.34 | 2.00 |
Items per page:
1 – 2 of 2