rs751510 chr11:72471508 G>A
- Sequence
gcacctcgcttcaaaactgcctgc[G/A]cttccaactcgtgctcggcttctg
- ASB in cell types
- erythroid cells foreskin keratinocyte HeLa Kyoto (cervical adenocarcinoma) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.59 | 0.93 | 1.39 | -0.11 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
