rs7517437 chr1:162235371 A>C
- Sequence
taagagcttgcctaagtgaagaag[A/C]cttccctggcgctggtattggctc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.49 | 0.56 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg, Thyroid