rs751795 chr2:224211087 C>T
- Sequence
aacaaatgtccaggataattcact[C/T]agattaagttgacagacaggaaat
- ASB in cell types
- induced pluripotent stem cells
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 1.73 | -1.79 | 1.00 | -2.98 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), cystatin c in serum, fasting insulin, height, homa-ir, infant head circumference, ldl cholesterol, total cholesterol, triglycerides