rs751919 chr16:50741834 T>G
- Sequence
atcagcttgagcttcccgcctcca[T/G]ccgccgctcttctctgccccgccc
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
- ASB for transcription factors
- ZN366_HUMAN GABPA_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN366_HUMAN | 2.17 | -2.70 | 1.50 | n/a | n/a | |||
| GABPA_HUMAN | 1.26 | n/a | 2.00 | n/a | No Hit | |||
| TYY1_HUMAN | 0.94 | 0.05 | 1.53 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood