rs752206 chr3:195263673 T>G
- Sequence
aaattacccagtctcgggtattgt[T/G]atggtgagagaaaacagacaagga
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.10 | 0.70 | 1.62 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Muscle_Skeletal