rs752371 chr17:4739520 C>T
- Sequence
gccctgctgtgccccgaccgtgcg[C/T]tcagtactcggcccgcgccatgcc
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.28 | -3.28 | 2.50 | n/a | No Hit | |||
| ZFHX2_HUMAN | 1.86 | -2.14 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Ovary, Pancreas, Thyroid, Whole_Blood