rs752474 chr7:20402840 G>C
- Sequence
ctgccacctacaggttagattcca[G/C]aaaatctaatcaacattagcaaac
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.41 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, height, major depressive disorder (broad definition) (males), major depressive disorder (narrow definition) (males), obesity with early age of onset (age >2), waist hip ratio