rs752502 chr19:33241856 T>C
- Sequence
cggagcccatgggacagaagcagg[T/C]cccccccaccgcccccggggaggg
- ASB in cell types
- OVCAR8 (high grade ovarian serous adenocarcinoma) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OVCAR8 (high grade ovarian serous adenocarcinoma) | 2.27 | -2.56 | 1.50 | |||
| bipolar neuron | 1.49 | -0.75 | 1.17 |
Items per page:
1 – 2 of 2