rs75253028 chr19:16829366 A>G
- Sequence
cgcctccaaaggcggaggctgcgc[A/G]tgcgcggcaggacctcgggcgggg
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -0.75 | 1.68 | 2.00 | 3.04 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
