rs7527936 chr1:241896445 A>G
- Sequence
tttttcttacaggacaatcatgag[A/G]gattgatctctaagtctgaaattg
- ASB in cell types
- HEK293 (embryonic kidney) NB69 (neuroblastoma) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.72 | 0.83 | 3.62 | |||
| NB69 (neuroblastoma) | 2.18 | -1.64 | 2.00 | |||
| HEK293T (embryonic kidney) | -0.19 | 0.79 | 2.00 |
Items per page:
1 – 3 of 3