rs753562 chr3:64151695 A>G
- Sequence
ggcaatactgagtcaagacattgc[A/G]ccattttccctgacactgtcctac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.18 | n/a | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, irritible bowel syndrome, maternal transmission distortion, mitral annular calcium, systolic blood pressure (sbp), tourettes syndrome, transmission distortion