rs753572 chr2:45975199 C>T
- Sequence
agtacccttcaagtggagttgttt[C/T]gagggttcattgagatgtattgta
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -2.25 | 1.92 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hip bone mineral density (bmd), ldl cholesterol, maternal transmission distortion, microalbuminuria, primary rhegmatogenous retinal detachment, sporadic creutzfeldt-jakob disease, tetrology of fallot, transmission distortion, urinary albumin-to-creatinine ratio