rs753930 chr15:101015509 T>A
- Sequence
cttatcttgggccttccccttcaa[T/A]gccctgttgcaatgccacagatgt
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.73 | 0.12 | 1.83 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.59 | 0.18 | 1.42 |
Items per page:
1 – 2 of 2