rs753947 chr7:129613012 G>A
- Sequence
ttaattgcttattttagagctggt[G/A]tcaatcgtgctgatttctttatgt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.73 | -0.28 | 1.97 | |||
| foreskin keratinocyte | 1.12 | n/a | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diastolic blood pressure (dbp), major depressive disorder, major depressive disorder (females), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), serum creatinine, triglycerides
GTEx eQTL Brain_Hippocampus, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Muscle_Skeletal, Nerve_Tibial, Thyroid