rs7539596 chr1:204171778 G>A
- Sequence
cttcttttagtcatggtggcctac[G/A]ttctagtaaaacttattatgtact
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.03 | 0.98 | 2.11 | |||
| LNCaP (prostate carcinoma) | 1.31 | 0.56 | 1.47 |
Items per page:
1 – 2 of 2