rs7541376 chr1:87712391 C>A
- Sequence
gagccaaagggtcaatttaaatag[C/A]taagcaggcagataatccaggtac
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -1.22 | 1.72 | 1.33 | 5.20 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, hypertension (early onset hypertension), ldl cholesterol, triglycerides change with statins