rs75451331 chr20:63685481 G>T
- Sequence
gctgatgctgcagaaagtcgggtg[G/T]cctcaggctcctgacggggctgca
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | 1.69 | -1.39 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid